NSL_112_20160624_HLSU - SRA

SRX4404531: NSL_112_20160624_HLSU
1 ILLUMINA (Illumina MiSeq) run: 114,222 spots, 57.3M bases, 32.2Mb downloads

Design: Large subunit haptophyte-specific fusion primers (HAP_LSU_F: GGURUCGGAGARGGUGAGAAUCC and LHapto20R_bis: TCAGACTCCTTGGTCCGTGTTTCT) containing Illumina-specific adaptors with 6 unique inline barcodes for the forward primer and 8 indices for the reverse primer were used. Triplicate PCR reactions were carried out for each genomic DNA sample with a 33 cocktail of 1.0 U Platinum High-Fidelity DNA Polymerase (Life Technologies, Carlsbad, CA): with 1X Hi-Fidelity buffer, 200 dNTP mix, 1.5 mM MgSO4, and 0.2 of each primer. 5-20 ng of template DNA were added to each PCR and included a no-template control for the run. PCR conditions were as follows: 2 min at 94, 30 s at 94, 30 s at 55, 3 min 68, with repetition from step 2 for 35 cycles followed by 5 min at 68. Resulting PCR tripiclate reactions were pooled and products were verified using a Caliper LabChip GX. Amplicons were cleaned with Agencourt AMPure XP magnetic beads and quantified with Quant-iT PicoGreen dsDNA Assay Kit. The amplicons were equimolarly pooled and the size was verified using the Agilent Bioanalyzer DNA 1000 chip. In addition, the concentration of the amplicon pool was checked with qPCR. The pool of amplicon libraries was diluted to 13 pM prior to clustering, and PhiX was added as a diversity control for the MiSeq sequencing run.

Submitted by: Marine Biological Laboratory

Study: Global Group I Haptophytes - Large Subunit

PRJNA477608 • SRP154348 • All experiments • All runs

show Abstracthide Abstract

The purpose of this project is to characterize the diversity of Group I Isochrysidales in Northern Hemisphere lakes, despite the conservation of the distinct biomarker signatures produced by these organisms.

Sample: Lake S6, Alaska

SAMN09475426 • SRS3558942 • All experiments • All runs

Organism: freshwater sediment metagenome

Library:

Name: NSL_112_20160624_HLSU

Instrument: Illumina MiSeq

Strategy: AMPLICON

Source: METAGENOMIC

Selection: PCR

Layout: PAIRED

Runs: 1 run, 114,222 spots, 57.3M bases, 32.2Mb

Run	# of Spots	# of Bases	Size	Published
SRR7536985	114,222	57.3M	32.2Mb	2020-06-01

ID:: 5986493

SRA

Sequence Read Archive

Result Filters

Send to:

Supplemental Content

Related information

Recent activity